China Surfactant Detergent & Cosmetics ›› 2026, Vol. 56 ›› Issue (5): 603-613.doi: 10.3969/j.issn.2097-2806.2026.05.007
• Basic research • Previous Articles Next Articles
Ruimin Zhang1,Lei Zhang2,*(
),Yafei He1,Limin Fan1
Received:2026-01-13
Revised:2026-04-21
Online:2026-05-22
Published:2026-06-22
Contact:
*E-mail: zhanglei1122334@126.com.
CLC Number:
Ruimin Zhang, Lei Zhang, Yafei He, Limin Fan. Research on development, efficacy and mechanism of xylooligosaccharides as a skin protective functional ingredient based on the Nrf2/TLR4 signaling pathway[J].China Surfactant Detergent & Cosmetics, 2026, 56(5): 603-613.
Tab.1
Primer sequences"
| 基因 | 上游引物序列(5'-3') | 下游引物序列(5'-3') |
|---|---|---|
| Bax | ATCCAAGACCAGGGTGTT | ATCTGGAAGAAGATGGGCTG |
| Bcl-2 | GGCCTCTGTITTGATTTCTCC | AGTGAAGTCACATGCCTGC |
| FLG | ATCTGAGGGCACTGAAAGGC | CACTTCCGTGCTGAGAGTGT |
| Claudin-1 | ATGACCCCAGTCAATGCCAG | GCTGGAAGGTGCAGGTTTTG |
| Claudin-4 | ACTGCCTGGAGGATGAAAGC | GGTGGACAGTTGCAGCAAAG |
| GAPDH | ATTCCATGGCACCGTCAAGG | TCGCCCCACTTGATTTTGGA |
Tab.2
Effect of XOS on the inflammatory factors in the culture supernatant of HaCaT cells stimulated with SA-CS"
| 组别 | ρ (IL-1β) / (pg/mL) | ρ (IL-8) / (pg/mL) | ρ (TNF-α) / (pg/mL) | ρ (PGE2) / (pg/mL) | ρ (COX2) / (pg/mL) |
|---|---|---|---|---|---|
| Blank | 4.90±0.39 | 10.89±0.96 | 3.06±0.34 | 54.01±5.89 | 101.58±14.30 |
| SA-CS | 50.13±3.64 | 208.06±19.53 | 20.31±1.92 | 297.23±48.77 | 417.76±18.49 |
| XOS-L | 30.78±3.36 | 136.78±17.95 | 15.79±0.85 | 203.41±11.83 | 339.39±19.53 |
| XOS-M | 21.13±0.99 | 73.63±6.67 | 9.31±0.80 | 145.71±13.51 | 234.28±21.64 |
| XOS-H | 9.91±0.93 | 29.44±3.57 | 5.72±0.54 | 94.19±10.11 | 158.71±15.79 |
| XOS-H+LPS | 29.13±2.32 | 148.31±23.11 | 13.92±1.76 | 229.79±26.06 | 351.03±47.35 |
| F | 298.751 | 160.912 | 177.524 | 83.257 | 139.237 |
| P | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
| [1] |
Li Z, Jiang R, Wang M, et al. Ginsenosides repair UVB-induced skin barrier damage in BALB/c hairless mice and HaCaT keratinocytes[J]. J. Ginseng Res., 2022, 46 (1) : 115-125.
doi: 10.1016/j.jgr.2021.05.001 pmid: 35035244 |
| [2] | Wang Z, Chen H, Wang Y, et al. Recombinant filaggrin-2 improves skin barrier function and attenuates ultraviolet B (UVB) irradiation-induced epidermal barrier disruption[J]. Int. J. Biol. Macromol., 2024, 281 (Pt 1) : 136064. |
| [3] | Chan L K W, Lee K W A, Lee C H, et al. Cosmeceuticals in photoaging: A review[J]. Skin Res. Technol., 2024, 30 (9) : e13730. |
| [4] |
Han K, Hong K B, Ahn Y, et al. Effects of collagen-tripeptide and galacto-oligosaccharide mixture on skin photoaging inhibition in UVB-exposed hairless mice[J]. Photochem. Photobiol., 2022, 98(5) : 1172-1181.
doi: 10.1111/php.13618 pmid: 35294989 |
| [5] | Kim D, Lee K R, Kim N R, et al. Combination of bifidobacterium longum and galacto-oligosaccharide protects the skin from photoaging[J]. J. Med. Food, 2021, 24 (6) : 606-616. |
| [6] |
Dai F, Zhang X, Ma G, et al. ACOD1 mediates Staphylococcus aureus-induced inflammatory response via the TLR4/NF-κB signaling pathway[J]. Int. Immunopharmacol., 2024, 140: 112924.
doi: 10.1016/j.intimp.2024.112924 |
| [7] |
Kline S N, Saito Y, Archer N K. Staphylococcus aureus proteases: Orchestrators of skin inflammation[J]. DNA Cell Biol., 2024, 43(10) : 483-491.
doi: 10.1089/dna.2024.0134 |
| [8] |
Wang J, Wu Y, Yang J, et al. Xylooligosaccharide and Akkermansia muciniphila synergistically ameliorate insulin resistance by reshaping gut microbiota, improving intestinal barrier and regulating NKG2D/NKG2DL signaling in gestational diabetes mellitus mice[J]. Food Res. Int., 2025, 201: 115634.
doi: 10.1016/j.foodres.2024.115634 |
| [9] |
Wanchai K, Yasom S, Tunapong W, et al. Prebiotic prevents impaired kidney and renal OAT3 functions in obese rats[J]. J. Endocrinol., 2018, 237 (1) : 29-42.
doi: 10.1530/JOE-17-0471 pmid: 29483238 |
| [10] | Batsalova T, Georgiev Y, Moten D, et al. Natural xylooligosaccharides exert antitumor activity via modulation of cellular antioxidant state and TLR4[J]. Int. J. Mol. Sci., 2022, 23 (18) : 10430. |
| [11] | Pereira M J, Pedrosa S S, Costa J R, et al. Sugarcane straw hemicellulose extraction by autohydrolysis for cosmetic applications[J]. Molecules, 2025, 30 (6) : 1208. |
| [12] | Yahyaoui M I, El Bouzidi A, Taibi M, et al. Dermatoprotective and anti-aging potentials of xylooligosaccharide- and glucose-fermented products by lactiplantibacillus plantarum S61[J]. Lett. Appl. Microbiol., 2026. Doi: 10.1093/lambio/ovag007. Online ahead of print. |
| [13] |
Jang Y, Na H W, Shin D Y, et al. Integrative analysis of RNA-sequencing and microarray for the identification of adverse effects of UVB exposure on human skin[J]. Front. Public Health, 2024, 12: 1328089.
doi: 10.3389/fpubh.2024.1328089 |
| [14] |
Abasubong K P, Li X F, Adjoumani J Y, et al. Effects of dietary xylooligosaccharide prebiotic supplementation on growth, antioxidant and intestinal immune-related genes expression in common carp Cyprinus carpio fed a high-fat diet[J]. J. Anim. Physiol. Anim. Nutr. (Berl), 2022, 106 (2) : 403-418.
doi: 10.1111/jpn.v106.2 |
| [15] |
Srinivasan B, Kolli A R, Esch M B, et al. TEER measurement techniques for in vitro barrier model systems[J]. J. Lab. Autom., 2015, 20 (2) : 107-126.
doi: 10.1177/2211068214561025 pmid: 25586998 |
| [16] |
Estrach S, Vivier C M, Tosello L, et al. Epithelial fibronectin meshwork controls skin regeneration[J]. J. Invest. Dermatol., 2025, 145 (12) : 3174-3186.
doi: 10.1016/j.jid.2025.04.014 |
| [17] | Wang B, Wang F, Qu L, et al. Prinsepia utilis royle polysaccharides promote skin barrier repair through the Claudin family[J]. Skin Res. Technol., 2024, 30 (7) : e13848. |
| [18] | Chotphruethipong L, Chanvorachote P, Reudhabibadh R, et al. Chitooligosaccharide from pacific white shrimp shell chitosan ameliorates inflammation and oxidative stress via NF-κB, Erk1/2, Akt and Nrf2/HO-1 pathways in LPS-induced RAW264.7 macrophage cells[J]. Foods, 2023, 12 (14) : 2740. |
| [19] | Zhu L, Ding M, Liu L, et al. Burdock fructooligosaccharide protects against diabetic nephropathy in mice by regulating Nrf2 signaling[J]. Pharmacol. Res. Perspect., 2025, 13 (3) : e70094. |
| [20] |
Bellezza I, Giambanco I, Minelli A, et al. Nrf2-Keap1 signaling in oxidative and reductive stress[J]. Biochim. Biophys. Acta Mol. Cell Res., 2018, 1865 (5) : 721-733.
doi: 10.1016/j.bbamcr.2018.02.010 |
| [21] | Yang C, Robledo-Avila F H, Partida-Sanchez S, et al. α-Hemolysin-mediated endothelial injury contributes to the development of Staphylococcus aureus-induced dermonecrosis[J]. Infect. Immun., 2024, 92 (8) : e0013324. |
| [22] |
Panchatcharam B S, Cooksley C M, Ramezanpour M, et al. Staphylococcus aureus biofilm exoproteins are cytotoxic to human nasal epithelial barrier in chronic rhinosinusitis[J]. Int. Forum Allergy Rhinol., 2020, 10 (7) : 871-883.
doi: 10.1002/alr.v10.7 |
| [23] | Kline S N, Orlando N A, Lee A J, et al. Staphylococcus aureus proteases trigger eosinophil-mediated skin inflammation[J]. Proc. Natl. Acad. Sci. U. S. A., 2024, 121 (6) : e2309243121. |
| [24] | Lallo S, Hardianti B, Djabir Y Y, et al. Piper retrofractum ameliorates imiquimod-induced skin inflammation via modulation of TLR4 axis and suppression of NF-κB activity[J]. Heliyon, 2023, 9 (9) : e20151. |
| [1] | Jun Liang, Xiaoming Shi. Whitening effect of glabridin and its mechanism [J]. China Surfactant Detergent & Cosmetics, 2026, 56(5): 635-643. |
| [2] | Xinyu Gao, Yanan Sun, Lishuang Li, Yucui Jin, Shuhua Ma, Yi Wang. Study on the repairing effect of Dong’ e Ejiao on skin barrier injury in mice [J]. China Surfactant Detergent & Cosmetics, 2026, 56(2): 236-244. |
| [3] | Jiaming Li, Xiaofeng Qiu, Huishan Guo, Jiankun Luo, Lishe Gan, Xuetao Xu. Preparation, structural characterization and moisturizing efficacy of proteins from Tricholoma matsutake [J]. China Surfactant Detergent & Cosmetics, 2026, 56(1): 98-106. |
| [4] | Yali Shen, Peilin Liu, Linli Liu, Limin Fan, Huanying Li. Effects of black bean peptide on UVB-induced activity and collagen secretion of human skin fibroblasts [J]. China Surfactant Detergent & Cosmetics, 2025, 55(9): 1179-1186. |
| [5] | Siyue Xie, Can Qin, Junmin Lin, Xiaochun Luo. The activity and skin-caring efficacy of amino acids/peptides fermented from meal protein [J]. China Surfactant Detergent & Cosmetics, 2025, 55(9): 1187-1197. |
| [6] | Li Shao, Jiawei Yue, Yan Li, Tao Li, Laiji Ma, Suzhen Yang. The effect of four oligosaccharides on the growth characteristics and beneficial functions of Cutibacterium acnes CCSM0331, isolated from a healthy facial skin [J]. China Surfactant Detergent & Cosmetics, 2025, 55(7): 895-901. |
| [7] | Fan Wu, Jiaqi Zhang, Yi Qin, Jun Wang, Zonghan Wu, Yao Pan. Progress of cosmetic active ingredients exerting skincare efficacy through cellular autophagy [J]. China Surfactant Detergent & Cosmetics, 2025, 55(6): 803-810. |
| [8] | Wucheng Yang, Yu Xie, Jian Wei, Ruifang Fan, Jianhua Tan, Shaofeng Xi. Application of confocal Raman spectroscopy in the evaluation of skin barrier function and permeability [J]. China Surfactant Detergent & Cosmetics, 2025, 55(4): 508-515. |
| [9] | Huabing Zhao, Yingtian Li, Xihan Wang, Zhengmei Huang, Fuping Lu. Skin microecology and microecological skincare products [J]. China Surfactant Detergent & Cosmetics, 2025, 55(3): 390-398. |
| [10] | Fei Liu, Qian Wang, Hui Liu, Suzhen Yang, Tingting Han, Tao Wu. Study on the effect of recombinant human collagen Ⅲ on anti-skin photoaging [J]. China Surfactant Detergent & Cosmetics, 2025, 55(11): 1452-1559. |
| [11] | Zixuan Lai, Yuxuan Song, Xuewei Duan, Shiyun Liu, Bing Liu, Minjun Zhang, Huiwen Yang. The protective effect and mechanism of crude polysaccharide from Broussonetia papyrifera flower on UV-induced skin photodamage [J]. China Surfactant Detergent & Cosmetics, 2024, 54(9): 1069-1077. |
| [12] | Shengpeng Li, Jing Li, Chao Liang, Ran Zhao, Xiaojie Zhang, Lili Sun. Protective effect of silk fibroin on UVB-induced skin injury [J]. China Surfactant Detergent & Cosmetics, 2024, 54(9): 1117-1124. |
| [13] | Meiling He,Limin Fan. Evaluation of anti-aging effect of percutaneous application of Silybum marianum extract [J]. China Surfactant Detergent & Cosmetics, 2024, 54(8): 981-987. |
| [14] | Zhaoyi Liu, Xinyu Chen, Yan Wang, Xue Li, Ruoxi Guo, Han Zhang. Study on the reparative effects of oxymatrine on impaired skin barrier function in mice [J]. China Surfactant Detergent & Cosmetics, 2024, 54(7): 777-783. |
| [15] | Wang Kun, Bai Xingyi, Yang Ruikun. Research on the application of regional cultural elements in the visual image design of daily chemical products [J]. China Surfactant Detergent & Cosmetics, 2023, 53(5): 574-580. |
|