重组人源胶原蛋白改善UV诱导小鼠皮肤光老化的作用

doi:10.3969/j.issn.2097-2806.2025.11.010

Abstract

Abstract:

This study investigates the effects of recombinant human collagen （R-HC） on UV-induced photoaging in mouse skin. The photoaging mouse model was established using UVA and UVB irradiation. Changes of skin wrinkles and epidermal thickness were systematically evaluated using the C-Cube multifunctional skin imaging analysis system, optical coherence tomography, and hematoxylin-eosin staining. Collagen fiber alterations were examined using two-photon excitation fluorescence imaging and liquid crystal polarization imaging techniques. Additionally, Gomori aldehyde fuchsin staining and RT-qPCR were employed to assess elastic fiber morphology and extracellular matrix metalloproteinase expression, respectively. The results show that R-HC significantly reduces skin wrinkles, increases stratum corneum and epidermal hydration, and decreases epidermal thickness in photoaged mice. Moreover, R-HC improves collagen fiber content and organization, reduces elastic fiber fragmentation and thickening, and regulates the relative mRNA expression of matrix metalloproteinase-3 and tissue inhibitor of metalloproteinase-1. In conclusion, R-HC mitigates UV-induced skin photoaging and has important application value for the development of products targeting photoaged skin.

Key words: recombinant human collagen, photoaging, wrinkles, collagen fibres, elastin fibres

CLC Number:

TQ658

Gaiying He, Jinghui Tang, Xuying Liu, Guirong Sun, Yi Wang. The protective effect of recombinant human collagen against UV-induced skin photoaging in mice[J].China Surfactant Detergent & Cosmetics, 2025, 55(11): 1444-1451.

Figures/Tables 7

Tab. 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

References 16

[1]	Bajgar R, Moukova A, Chalupnikova N, et al. Differences in the effects of broad-band UVA and narrow-band UVB on epidermal keratinocytes[J]. Int. J. Environ. Res. Public. Health., 2021, 18 (23) : 12480.
[2]	Mavrogonatou E, Angelopoulou M, Rizou S V, et al. Activation of the JNKs/ATM-p53 axis is indispensable for the cytoprotection of dermal fibroblasts exposed to UVB radiation[J]. Cell. Death. Dis., 2022, 13 (7) : 647.
[3]	Liu S, Mohri S, Tsukamoto M, et al. Preventive effects of dietary fucoxanthin on ultraviolet A induced photoaging in hairless mice[J]. J. Sci. Food. Agric., 2025, 105 (1) : 453-464. doi: 10.1002/jsfa.v105.1
[4]	Lee S G, Nguyen N H, Lee Y I, et al. The Role of Cacao powder in enhancing skin moisture and reducing wrinkles: a 12-week clinical trial and in vitro study[J]. Curr. Issues. Mol. Biol., 2024, 46 (11) : 12574-12587. doi: 10.3390/cimb46110746
[5]	Wu Ye, Hu Cheng, Li Yaxing, et al. A versatile composite hydrogel with spatiotemporal drug delivery of mesoporous ZnO and Recombinant Human Collagen for diabetic infected wound healing[J]. Biomacromolecules, 2024, 25 (12) : 7878-7893. doi: 10.1021/acs.biomac.4c01155 pmid: 39570390
[6]	Kong Weishi, Bao Yulu, Li Wei, et al. Collaborative enhancement of diabetic wound healing and skin regeneration by recombinant human collagen hydrogel and hADSCs[J]. Adv. Healthc. Mater., 2024, 13 (29) : e2401012.
[7]	Ye Mingzhu, Fan Yirui, Fu Caihong, et al. Biocompatible recombinant type Ⅲ collagen enhancing skin repair and anti-wrinkle effects[J]. Biomater. Sci., 2024, 12 (23) : 6114-6122. doi: 10.1039/D4BM01284D
[8]	Gong Meihua, Zhai Xu, Yu Li, et al. ADSCs inhibit photoaging-and photocarcinogenesis-related inflammatory responses and extracellular matrix degradation[J]. J. Cell. Biochem., 2020, 121: 1205-1215. doi: 10.1002/jcb.29354 pmid: 31468588
[9]	Dusabimana T, Karekezi J, Nugroho T A, et al. Oyster hydrolysate ameliorates UVB-induced skin dehydration and barrier dysfunction[J]. Life. Sci., 2024, 358: 123149. doi: 10.1016/j.lfs.2024.123149
[10]	Park G C, Lee I, Yun J, et al. Upcycled canola meal extract mitigates UVB-induced skin wrinkling by regulating photoaging-related biomarkers in hairless mice[J]. Nutr. Res., 2024, 127: 108-122. doi: 10.1016/j.nutres.2024.06.002
[11]	Janson D, Saintigny G, Mahé C, et al. Papillary fibroblasts differentiate into reticular fibroblasts after prolonged in vitro culture[J]. Exp. Dermatol., 2013, 22 (1) : 48-53. doi: 10.1111/exd.12069 pmid: 23278894
[12]	Gao Wei, Yuan Limin, Zhang Yue, et al. miR-1246-overexpressing exosomes improve UVB-induced photoaging by activating autophagy via suppressing GSK3β[J]. Photochem. Photobiol. Sci., 2024, 23 (5) : 957-972. doi: 10.1007/s43630-024-00567-w
[13]	Kim H K. Garlic supplementation ameliorates UV-Induced photoaging in hairless mice by regulating antioxidative activity and MMPs expression[J]. Molecules., 2016, 21 (1) : 70.
[14]	Jariwala N, Ozols M, Eckersley A, et al. Prediction, screening and characterization of novel bioactive tetrapeptide matrikines for skin rejuvenation[J]. Br. J. Dermatol., 2024, 191 (1) : 92-106. doi: 10.1093/bjd/ljae061 pmid: 38375775
[15]	Weihermann A C, Lorencini M, Brohem C A, et al. Elastin structure and its involvement in skin photoageing[J]. Int. J. Cosmet. Sci., 2017, 39 (3) : 241-247. doi: 10.1111/ics.2017.39.issue-3
[16]	Hwang E, Lee D G, Park S H, et al. Coriander leaf extract exerts antioxidant activity and protects against UVB-induced photoaging of skin by regulation of procollagen type I and MMP-1 expression[J]. J. Med. Food., 2014, 17 (9) : 985-995. doi: 10.1089/jmf.2013.2999

基因	方向	引物
MMP-3	F	tgtcactggtaccaacctattc
MMP-3	R	tctcaggtttccagagagttaga
TIMP-1	F	gcaaagagctttctcaaagacc
TIMP-1	R	ctccagtttgcaagggatagat

The protective effect of recombinant human collagen against UV-induced skin photoaging in mice

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 16

Related Articles 15

Metrics

Comments

Recommended 10

[1]	Fei Liu,Qian Wang,Hui Liu,Suzhen Yang,Tingting Han,Tao Wu. Study on the effect of recombinant human collagen Ⅲ on anti-skin photoaging [J]. China Surfactant Detergent & Cosmetics, 2025, 55(11): 1452-1559.
[2]	Qingyu Guo,Dan Cao,Dong Chen. Evaluation of the whitening effect and antioxidant activity of isorosmanol, an active ingredient of Rosmarinus officinalis L. [J]. China Surfactant Detergent & Cosmetics, 2025, 55(10): 1306-1312.
[3]	Lin Sun, Man Zhang. Study on the anti-photoaging effect of Paulownia fortunei leaf extract [J]. China Surfactant Detergent & Cosmetics, 2024, 54(9): 1092-1098.
[4]	Ya Zhang, Hao Zhou, Rong Wang, Zengmiao Hou, Wentao Huang, Lu Yang. Characterization of recombinant elastin and its roles in ultraviolet-induced skin photoaging [J]. China Surfactant Detergent & Cosmetics, 2024, 54(9): 1106-1116.
[5]	Guanru Shao, Kunyang Zhang. Rhein attenuates UVB-induced skin photoaging injury by inhibiting p38 MAPK phosphorylation [J]. China Surfactant Detergent & Cosmetics, 2024, 54(7): 836-843.
[6]	Gengtao Han, Zhuo Dong, Renhui Yao. Effects of sesamolin on AQP3 expression and Nrf2 signaling pathway activation in skin photoaging mice [J]. China Surfactant Detergent & Cosmetics, 2024, 54(4): 431-438.
[7]	Hui Liu, Fang Liu. Study on the whitening effect and antioxidation of isoastilbin [J]. China Surfactant Detergent & Cosmetics, 2024, 54(11): 1368-1374.
[8]	Anna Wang, Mengjie Fang, Chao Tang, Tianxiang Yue. Protective effect and antioxidant mechanism of Danshensu on UVB-induced skin photoaging in mice [J]. China Surfactant Detergent & Cosmetics, 2024, 54(1): 65-72.
[9]	Yueying Ma, Qi Liu, Meng Jia, Junjie Wang, Wei Wang, Hua Zhao. A study on the method of evaluating the efficacy of a firming cosmetic [J]. China Surfactant Detergent & Cosmetics, 2024, 54(1): 73-79.
[10]	Fan Jiayi, Ma Ling, Chen Timson, Chang Kuan, Wang Jing. Scientific foundations of hair and scalp care （Ⅴ）Hair photoaging and its protection [J]. China Surfactant Detergent & Cosmetics, 2023, 53(5): 503-510.
[11]	Chen Yiwen, Wen Xia, Huang Jiancong, Zhang Shuyao, Zheng Yali, Xie Xiaobao. The research progress of skin microecology and probiotic for skin anti-photoaging [J]. China Surfactant Detergent & Cosmetics, 2023, 53(4): 459-464.
[12]	Yu Ding, Yi Wu, Mingshi Ren, Zihan Li, Bo Liu. Protective effect of compound clove volatile oil on UV induced skin photoaging damage in mice [J]. China Surfactant Detergent & Cosmetics, 2023, 53(12): 1385-1391.
[13]	Tang Jinghui,Wang Yi,Ma Shuhua,Sun Yanan,He Gaiying,He Zhongmei. Protective effect of pilose antler extracts against UVB-induced skin photoaging in mice [J]. China Surfactant Detergent & Cosmetics, 2022, 52(9): 969-974.
[14]	Wu Simin,Man Jiaxu,Yuan Mei,Gao Ziqi,Wang Dongxue,Zhang Dongying. Chlorogenic acid ameliorates UVB-induced HaCaT inflammation through SIRT6 [J]. China Surfactant Detergent & Cosmetics, 2022, 52(11): 1195-1201.
[15]	Yin Qingfei,Chen Tian. Dynamic changes of gene expression induced by long-wave ultraviolet radiation in human dermal fibroblasts [J]. China Surfactant Detergent & Cosmetics, 2021, 51(9): 874-880.