油莎草根油对抑制TNF-α诱导的人真皮成纤维细胞炎症和衰老的研究

doi:10.3969/j.issn.2097-2806.2026.03.004

Abstract

Abstract:

Cyperus esculentus root oil （CEL） is a plant of significant economic value, rich in unsaturated fatty acids like oleic acid, linoleic acid, and linolenic acid. In this study, human dermal fibroblasts （HSF） were used to create an inflammatory model, and the impact of cold-pressed oil from CEL on the secretion of inflammatory factors was assessed. The results showed that CEL significantly inhibited IL-6 and IL-1β that were secreted by HSF cells induced by tumor necrosis factor-α （TNF-α）（P<0.000 1）, with inhibition rates of 50.79% and 20.26%, respectively. Furthermore, CEL markedly enhanced the secretion of the anti-inflammatory factor IL-10 （P<0.01）, with an improvement rate of 94.42%. The study further explored the impact of CEL on collagen type I （Col-I） and hyaluronic acid （HA） secretion in the cells. The results demonstrated that CEL effectively increased Col-I secretion by 26.15% （P<0.000 1） and HA by 30.2% （P<0.000 1） when it was administered at a maximum safe mass fraction of 6%, which consequently showed its potential anti-aging and moisturizing properties. Additionally, fluorescence real-time quantitative polymerase chain reaction （PCR） experiments confirmed that CEL significantly inhibited the TNF-α-induced expression of IL-6, IL-1β, and matrix metalloproteinases （MMP-1, 3, 9） in HSF cells, while promoted the mRNA expression levels of IL-10 and hyaluronic acid synthase. This modulation suggested that CEL exerted anti-inflammatory and anti-aging effects. Finally, the oil’s anti-inflammatory, anti-senility, and moisturizing effects were validated through the clinical evaluations. In summary, CEL, as a natural raw material abundant in unsaturated fatty acids, shows promising potential for further development and usage in cosmetics due to its anti-inflammatory, anti-aging, and moisturizing properties in personal care.

Key words: Cyperus esculentus root oil, anti-inflammatory, anti-aging, moisturizing, personal care

CLC Number:

TQ658

Wanping Zhang,Jiayi Wang,Donghan Jia,Meiling Mo,Ying Liang,Changmei Peng,Yue Wang. Study on the inhibition of TNF-α-induced inflammation and aging in human skin fibroblast cells by Cyperus esculentus root oil[J].China Surfactant Detergent & Cosmetics, 2026, 56(3): 302-313.

Figures/Tables 9

Tab.1

Fig.1

Tab.2

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

Fig.7

References 40

[1]	Yu Yali, Lu Xiaoyu, Zhang Tiehua, et al. Tiger nut (Cyperus esculentus L.) : nutrition, processing, function and applications[J]. Foods, 2022, 11 (4) : 601.
[2]	Roselló-Soto E, Poojary M M, Barba J F, et al. Tiger nut and its by-products valorization: from extraction of oil and valuable compounds to development of new healthy products[J]. Innovative Food Science and Emerging Technologies, 2018, 45: 306-312.
[3]	Guo Tingting, Wan Chuyun, Huang Fenghong, et al. Evaluation of quality properties and antioxidant activities of tiger nut (Cyperus esculentus L.) oil produced by mechanical expression or/with critical fluid extraction [J]. LWT-Food Science and Technology, 2021, 141 (prepublish) : DOI:10.1016/J.LWT.2021.110915.
[4]	Abdalla S, Aroua K M, Gew T L. A comprehensive review of plant-based cosmetic oils (virgin coconut oil, olive oil, argan oil, and jojoba oil) : chemical and biological properties and their cosmeceutical applications [J]. ACS Omega, 2024, 9 (44) : 44019-44032.
[5]	Bialek A, Bialek M, Jelinska M, et al. Fatty acid profile of new promising unconventional plant oils for cosmetic use[J]. International Journal of Cosmetic Science, 2016, 38 (4) : 382-388.
[6]	Ahmad A, Ahsan H. Lipid-based formulations in cosmeceuticals and biopharmaceuticals[J]. Biomedical Dermatology, 2020, 4 (2) : 108. DOI:10.1186/s41702-020-00062-9.
[7]	Zhang Shoubing, Duan Enkui. Fighting against skin aging: the way from bench to bedside[J]. Cell Transplantation, 2018, 27 (5) : 729-738.
[8]	Sehyeon P, Kwoun H K. Development of skin-permeable flexible liposome using ergosterol esters containing unsaturated fatty acids[J]. Chemistry and Physics of Lipids, 2023, 250: 105270.
[9]	Li Xia, Li Chentao, Zhang Wanying, et al. Inflammation and aging: signaling pathways and intervention therapies[J]. Signal Transduction and Targeted Therapy, 2023, 8 (1) : 239.
[10]	Antero S, Kai K, Anu K. Photoaging: UV radiation-induced inflammation and immunosuppression accelerate the aging process in the skin[J]. Inflammation Research, 2022, 71 (7-8) : 817-831.
[11]	Pilkington S M, BulfonePaus S, Griffiths C E M, et al. Inflammaging and the skin[J]. The Journal of Investigative Dermatology, 2020, 141 (4S) :1087-1095.
[12]	Rapozo G G, Porto P A, Leandro S O D, et al. Hallmarks of aging in macrophages: consequences to skin inflammaging[J]. Cells, 2021, 10 (6) : 1323.
[13]	Agrawal R, Hu A, Bollag B W. The skin and inflamm-aging[J]. Biology, 2023, 12 (11) : 1396.
[14]	Shaw A C, Goldstein D R, Montgomery R R. Age-dependent dysregulation of innate immunity[J]. Nature Reviews. Immunology, 2013, 13 (12) : 875-887.
[15]	Moore E M, Charles W, Slavko K. The enigma of bioactivity and toxicity of botanical oils for skin care[J]. Frontiers in Pharmacology, 2020, 11: 785.
[16]	He Mei, Qin Chunxue, Wang Xu, et al. Plant unsaturated fatty acids: biosynthesis and regulation[J]. Frontiers in Plant Science, 2020, 11: 390.
[17]	Hwa J L, Jooho P, Wook D S. The molecular mechanism of polyphenols with anti-Aging activity in aged human dermal fibroblasts[J]. Molecules, 2022, 27 (14) : 4351.
[18]	Antero S. The plasticity of fibroblasts: a forgotten player in the aging process[J]. Ageing Research Reviews, 2023, 89: 101995.
[19]	Lago C J, Puzzi B M. The effect of aging in primary human dermal fibroblasts[J]. Public Library of Science One, 2019, 14 (7) : e0219165.
[20]	Huang Tsehung, Wang Peiwen, Yang Shihchun, et al. Cosmetic and therapeutic applications of fish oil’s fatty acids on the skin[J]. Marine Drugs, 2018, 16 (8) : 256.
[21]	Zhang Runyang, Liu Aobo, Liu Chen, et al. Effects of different extraction methods on the physicochemical properties and storage stability of tiger nut (Cyperus esculentus L.) oil [J]. LWT-Food Science and Technology, 2023, 173: 114269
[22]	Wang Peiyu, Quan Qianghua, Wei Jing, et al. Effect of inflammatory factor TNF-α on human skin cells and screening of effective extracts[J]. China Surfactant Detergent & Cosmetics, 2022, 52 (3) : 287-293.
[23]	Jia Donghan, Wu Yanyan, Gong Heji, et al. Evaluation of the repairing ability of different active ingredients on the lip[J]. China Surfactant Detergent & Cosmetics, 2025, 55 (8) : 1024-1034.
[24]	Andrej K, Monika K, Iva H, et al. Time-Dependent differences in the effects of oleic acid and oleyl alcohol on the human skin barrier[J]. Molecular Pharmaceutics, 2023, 20: 6237-6245.
[25]	Zhang Yiming, Sun Shangde. Tiger nut (Cyperus esculentus L.) oil: a review of bioactive compounds, extraction technologies, potential hazards and applications [J]. Food Chemistry: X, 2023, 19: 100868.
[26]	Peres A, Dantas R, Ferreira A, et al. Extra virgin olive oil supplementation reduces inflammation in the arcuate nucleus of the hypothalamus and improves metabolic parameters in obese rats[J]. Nutritional Neuroscience, 2025, 29 (1): 1-16.
[27]	Consuelo S, Soledad L, Sergio P L M, et al. Update on anti-Inflammatory molecular mechanisms induced by oleic acid[J]. Nutrients, 2023, 15(1) : 224.
[28]	Papawee S, Yasuhiro K, D L J L G V, et al. The anti-inflammatory effect of agaricus brasiliensis is partly due to its linoleic acid content[J]. Food & Function, 2017, 8 (11) : 4150-4158.
[29]	Samira R, Ghazaleh S, Farideh S, et al. The effects of conjugated linoleic acid supplementation on inflammatory cytokines and adipokines in adults: a grade-assessed systematic review and dose-response meta-analysis[J]. Frontiers in Immunology, 2023, 14: 1092077.
[30]	Zhang Beibei, Zeng Mengnan, Wang Yangyang, et al. Oleic acid alleviates LPS-induced acute kidney injury by restraining inflammation and oxidative stress via the Ras/MAPKs/PPAR-γ signaling pathway[J]. Phytomedicine, 2022, 94: 153818.
[31]	Hwa J L, Jooho P, Wook D S. The molecular mechanism of polyphenols with anti-aging activity in aged human dermal fibroblasts[J]. Molecules, 2022, 27 (14) : 4351.
[32]	Isabela M R A, Lorena M S. Collagen: a review on its sources and potential cosmetic applications[J]. Journal of Cosmetic Dermatology, 2018, 17 (1) : 20-26.
[33]	Liu Helei, Dong Junjuan, Du Rina, et al. Collagen study advances for photoaging skin[J]. Photodermatology, Photoimmunology & Photomedicine, 2023, 40 (1) : 12931.
[34]	Borges A E M C, Pacheco D H S D, Carolini M, et al. Effects of percutaneous collagen induction therapy associated with hyaluronic acid on inflammatory response, oxidative stress, and collagen production[J]. Inflammation, 2020, 43 (6) : 1-13.
[35]	Kaya G, Kaya A, Saurat J. Induction of hyalurosome by topical hyaluronate fragments: results in superficial filling of the skin complementary to hyaluronate filler injections[J]. Dermatopathology, 2019, 6 (2) : 45-49.
[36]	Shinya S, Yukiko M, Yuta Y, et al. Pro-inflammatory cytokines suppress HYBID (hyaluronan (HA)-binding protein involved in HA depolymerization/KIAA1199/CEMIP)-mediated HA metabolism in human skin fibroblasts[J]. Biochemical and Biophysical Research Communications, 2021, 539: 77-82.
[37]	Wang Chen, Zhang Songrui, Huang Longao, et al. Chemerin promotes MAPK/ERK activation to induce inflammatory factor production in rat synoviocytes[J]. Experimental and Therapeutic Medicine, 2022, 24(5) : 684.
[38]	Xuan S H, Park Y M, Park S H, et al. Suppression of ultraviolet B-mediated matrix metalloproteinase generation by sorbus commixta twig extract in human dermal fibroblasts[J]. Photochemistry and Photobiology, 2018, 94 (2) : 370-377.
[39]	Yenchi L, Hu Haochun, Yu Szuyin, et al. Development on potential skin anti-aging agents of cosmos caudatus kunth via inhibition of collagenase, MMP-1 and MMP-3 activities[J]. Phytomedicine, 2023, 110, 154643.
[40]	Ågren S M, Schnabel R, Christensen H L, et al. Tumor necrosis factor-α-accelerated degradation of type I collagen in human skin is associated with elevated matrix metalloproteinase MMP-1 and MMP-3 ex vivo[J]. European Journal of Cell Biology, 2015, 94 (1) : 12-21.

Gene	Forward primer （5'-3'）	Reverse Primer （5'-3'）
IL-6	TACCCCCAGGAGAAGATTCC	AGTGCCTCTTTGCTGCTTTC
IL-10	TACCTGGAGGAGGTGATGC	GGCCTTGCTCTTGTTTTCAC
IL-1β	TGGAGAACACCACTTGTTGCTCCA	AAACAGATGAAGTGCTCCTTCCAGG
MMP-1	GGGAATAAGTACTGGGCTGTTCAG	CCTCAGAAAGAGCAGCATCGATATG
MMP-3	ACTTCGGATGCCCAGGAAAG	TGAGGACACCAGCATGAACC
MMP-9	GCCATTCACGTCGTCCTTAT	TTGACAGCCGACAAGAAGTGG
HAS-1	TGGAGAACACCACTTGTTGCTCCA	TTCTTTATGTGACTCATCTGTCTCACCGG

Fatty acid name	Relative proportion/%	Absolute content/ （mg/kg oil）
C14:0	0. 03±0. 00	284. 13±9. 67
C15:0	0. 01±0. 00	123. 53±2. 64
C16:0	12. 60±0. 08	109 201. 09±1 471. 70
C16:1	0. 19±0. 00	1 653. 59±5. 21
C17:1	0. 04±0. 01	377. 71±96. 72
C18:0	3. 12±0. 01	27 012. 72±85. 25
C18:1	72. 88±0. 03	631 369. 07±3 507. 06
C18:2	10. 11±0. 03	87 595. 25±770. 13
C18:3	0. 17±0. 00	1456. 18±0. 73
C20:0	0. 49±0. 01	4 215. 32±81. 62
C20:1	0. 21±0. 01	1 859. 25±29. 98
C22:0	0. 05±0. 00	458. 46±14. 05
C22:1	0. 02±0. 01	147. 54±7. 05
C24:0	0. 07±0. 01	597. 10±69. 84

Study on the inhibition of TNF-α-induced inflammation and aging in human skin fibroblast cells by Cyperus esculentus root oil

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 9

References 40

Related Articles 15

Metrics

Comments

Recommended 0

[1]	Congrui Zeng,Qi Liu,Sisi Chang,Hua Zhao. Research on the impact of environmental temperature and humidity on sensory evaluation and moisturizing efficacy of cosmetics [J]. China Surfactant Detergent & Cosmetics, 2026, 56(3): 339-346.
[2]	Xiaoling Tan,Jiaxin Kang. Rapid determination of DHA in sturgeon caviar extracts and its correlation with bioactive efficacy [J]. China Surfactant Detergent & Cosmetics, 2026, 56(3): 347-353.
[3]	Rui Mi, Xuejun Li, Linmei Wang, Xinghe Chen, Xinyue Jia, Xingfan Du. Study on the preparation of tussah silk fibroin peptide liposomes and their anti-photodamage effects [J]. China Surfactant Detergent & Cosmetics, 2026, 56(1): 73-81.
[4]	Jiaming Li, Xiaofeng Qiu, Huishan Guo, Jiankun Luo, Lishe Gan, Xuetao Xu. Preparation, structural characterization and moisturizing efficacy of proteins from Tricholoma matsutake [J]. China Surfactant Detergent & Cosmetics, 2026, 56(1): 98-106.
[5]	Sijia Yang, Hui Liu, Yongbo Lyu, Yuxin Huang, Shujing Li. Preparation and efficacy study of dendrobium polysaccharide/purulan nanofiber solid absorbable mask [J]. China Surfactant Detergent & Cosmetics, 2025, 55(7): 879-886.
[6]	Xingting Wang, Zhaojuan Shi, Jun Wu, Chuanxun Yuan, Risheng Jin. Preparation and study of Camellia oleifera seed oil-ceramide nanoemulsion [J]. China Surfactant Detergent & Cosmetics, 2025, 55(6): 739-746.
[7]	Yuewen Ma, Xiaojing Li, Xuefeng Huang, Xian Chen, Chunli Wang. Protective effect and mechanism of Hedyotis diffusa extract on mice with solar dermatitis [J]. China Surfactant Detergent & Cosmetics, 2025, 55(5): 581-590.
[8]	Keran Feng, Xiaoming Wu, Liangbo Ma, Yu Sun. Determination of 21 nonsteroidal anti-inflammatory drugs in cosmetics by high performance liquid chromatography-tandem mass spectrometry [J]. China Surfactant Detergent & Cosmetics, 2025, 55(3): 399-406.
[9]	Ranran Dong,Yanhua Liu. Preparation of Moringa oleifera leaf ethanolic extract and study on its antibacterial and anti-inflammatory activities [J]. China Surfactant Detergent & Cosmetics, 2025, 55(2): 209-215.
[10]	Jianing Li, Shuyao Feng, Chun Zhang, Zhaohui Ge, Zhenshen Gao, Haijuan Zhang. Research progress of resveratrol in skin repair application [J]. China Surfactant Detergent & Cosmetics, 2025, 55(12): 1582-1588.
[11]	Peipei Li, Xiaoming Xu, Qiang Zhang, Yangyang Fang, Huiliang Li. Study on anti-aging and soothing effects of lily flower peptides [J]. China Surfactant Detergent & Cosmetics, 2025, 55(11): 1460-1467.
[12]	Zhiming Wei, Yaling Wang. Study and analysis of antibacterial and anti-inflammatory activity of extracts of Rhizoma imperatae in oral care products [J]. China Surfactant Detergent & Cosmetics, 2024, 54(9): 1086-1091.
[13]	Ting Yang,Huawen Li,Xun Xu,Honghui Guo,Tangbin Zou,Enqin Xia. The anti-aging potential of peptides from fermented Nannochloropsis sp. [J]. China Surfactant Detergent & Cosmetics, 2024, 54(8): 921-929.
[14]	Minjia Yuan,Qi Li,Cuicui Zhu,Hang Tie. Comparation of azelaic acid and chitosan encapsulated-azelaic acid complex in skin absorption efficiency and anti-inflammatory capability [J]. China Surfactant Detergent & Cosmetics, 2024, 54(8): 956-965.
[15]	Meiling He,Limin Fan. Evaluation of anti-aging effect of percutaneous application of Silybum marianum extract [J]. China Surfactant Detergent & Cosmetics, 2024, 54(8): 981-987.