人真皮成纤维细胞受长波紫外线辐照引起基因表达动态变化

doi:10.3969/j.issn.1001-1803.2021.09.010

Abstract

Abstract:

The dynamic changes of extracellular matrix, cell cycle and senescence-related genes at mRNA level in human primary dermal fibroblasts were studied by irradiated with different cumulative doses of ultraviolet UVA （1-7 days）. The results show that the expression of the collagen genes COL1A2 and COL4A1 is up-regulated at day 1 and decreases at day 3, while the mRNA level of the elastin gene ELN remains unchanged at day 1 and decreases at day 3. The expression of the matrix metalloproteinase genes MMP1 and MMP9 increases significantly at day 5 after UVA irradiation. Further studies show that the cell cycle is arrested in S phase and G2/M phase after 3 and 5 days after UVA irradiation. The expression of cell cycle related gene CDKN2A is down-regulated, and that of TP53 gene is up-regulated at first and then down-regulated. CDKN1A gene is up-regulated, and reaches the highest level at day 3 after UVA irradiation. Compared with the control group, the expression of aging-related genes SIRT1 and HDAC1 is up-regulated at first, then decreases, and increases again. The results show that the changes of cell senescence induced by UVA irradiation is a programmed regulation process, and different groups of genes in fibroblasts show diverse trends of dynamic changes under UVA irradiation. The suitable biomarkers should be selected according to the specific aims in the application of cell senescence model for researching anti-aging effect of cosmetics.

Key words: dermal fibroblasts, photoaging, ultraviolet A, extracellular matrix, cell cycle, cosmetics

CLC Number:

TQ658

Yin Qingfei,Chen Tian. Dynamic changes of gene expression induced by long-wave ultraviolet radiation in human dermal fibroblasts[J].China Surfactant Detergent & Cosmetics, 2021, 51(9): 874-880.

Figures/Tables 5

Tab. 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

References 24

[1]	Makrantonaki E, Vogel M, Scharffetter-Kochanek K, et al. Skin aging: molecular understanding of extrinsic and intrinsic processes[J]. Hautarzt, 2015, 66(10): 730-737. doi: 10.1007/s00105-015-3692-z pmid: 26385893
[2]	Flament F, Bazin R, Laquieze S, et al. Effect of the sun on visible clinical signs of aging in Caucasian skin[J]. Clin. Cosmet. Investig. Dermatol., 2013, 6:221-232.
[3]	Holick M F. Sunlight, UV Radiation, vitamin D, and skin cancer: how much sunlight do we need?[J]. Adv. Exp. Med. Biol., 2020, 1268:19-36.
[4]	Yamaba H, Haba M, Kunita M, et al. Morphological change of skin fibroblasts induced by UV Irradiation is involved in photoaging[J]. Exp. Dermatol., 2016, 25(Suppl 3): 45-51. doi: 10.1111/exd.13084
[5]	Naidoo K, Hanna R, Birch-Machin M A. What is the role of mitochondrial dysfunction in skin photoaging?[J]. Exp. Dermatol., 2018, 27(2): 124-128. doi: 10.1111/exd.2018.27.issue-2
[6]	Clydesdale G J, Dandie G W, Muller H K. Ultraviolet light induced injury: immunological and inflammatory effects[J]. Immunol. Cell Biol., 2001, 79(6): 547-568. pmid: 11903614
[7]	Guerra K C, Zafar N, Crane J S. Skin cancer prevention[M/OL]. Treasure Island (FL): StatPearls Publishing, 2020[2020-10-25]. https://www.ncbi.nlm.nih.gov/books/NBK519527/
[8]	Yoshimoto S, Yoshida M, Ando H, et al. Establishment of photoaging in vitro by repetitive UVA irradiation: induction of characteristic markers of senescence and its prevention by PAPLAL with potent catalase activity[J]. Photochem. Photobiol., 2018, 94(3): 438-444. doi: 10.1111/php.12871 pmid: 29253323
[9]	Nakyai W, Tissot M, Humbert P, et al. Effects of repeated UVA irradiation on human skin fibroblasts embedded in 3D tense collagen matrix[J]. Photochem. Photobiol., 2018, 94(4): 715-724. doi: 10.1111/php.2018.94.issue-4
[10]	Park Y M, Park S N. Inhibitory effect of lupeol on MMPs expression using aged fibroblast through repeated UVA irradiation[J]. Photochem. Photobiol., 2019, 95(2): 587-594. doi: 10.1111/php.13022
[11]	Nakyai W, Saraphanchotiwitthaya A, Viennet C, et al. An in vitro model for fibroblast photoaging comparing single and repeated UVA irradiations[J]. Photochem. Photobiol., 2017, 93(6): 1462-1471. doi: 10.1111/php.2017.93.issue-6
[12]	Bladier C, Wolvetang E J, Hutchinson P, et al. Response of a primary human fibroblast cell line to H₂O₂ : senescence-like growth arrest or apoptosis?[J]. Cell Growth Differ., 1997, 8(5): 589-598. pmid: 9149910
[13]	Furukawa A, Tada-Oikawa S, Kawanishi S, et al. H₂O₂ accelerates cellular senescence by accumulation of acetylated p53 via decrease in the function of SIRT1 by NAD+ depletion[J]. Cell Physiol. Biochem., 2007, 20(1-4): 45-54. pmid: 17595514
[14]	Wang Z, Wei D, Xiao H. Methods of cellular senescence induction using oxidative stress[J]. Methods Mol. Biol., 2013, 1048:135-144. doi: 10.1007/978-1-62703-556-9_11 pmid: 23929103
[15]	Placzek M, Przybilla B, Kerkmann U, et al. Effect of ultraviolet (UV) A, UVB or ionizing radiation on the cell cycle of human melanoma cells[J]. Br. J. Dermatol., 2007, 156(5): 843-847. doi: 10.1111/bjd.2007.156.issue-5
[16]	Moll U M, Petrenko O. The MDM2-p53 interaction[J]. Mol. Cancer. Res., 2003, 1(14): 1001-1008. pmid: 14707283
[17]	Girard P M, Pozzebon M, Delacote F, et al. Inhibition of S-phase progression triggered by UVA-induced ROS does not require a functional DNA damage checkpoint response in mammalian cells[J]. DNA Repair (Amst), 2008, 7(9): 1500-1516. doi: 10.1016/j.dnarep.2008.05.004
[18]	Graindorge D, Martineau S, Machon C, et al. Singlet oxygen-mediated oxidation during UVA radiation alters the dynamic of genomic DNA replication[J]. PLoS One, 2015, 10(10): e0140645. doi: 10.1371/journal.pone.0140645
[19]	Huang J, Gan Q, Han L, et al. SIRT1 overexpression antagonizes cellular senescence with activated ERK/S6k1 signaling in human diploid fibroblasts[J]. PLoS One, 2008, 3(3): e1710. doi: 10.1371/journal.pone.0001710
[20]	Zhang W J, Ji W D, Yang L Q, et al. Alterations of overall histone acetylation during cellular replicative senescence and premature senescence of human embryonic lung fibroblasts[J]. J. Med. Mol. Biol., 2008, 5(5): 387-392.
[21]	Tito A, Barbulova A, Zappelli C, et al. The growth differentiation factor 11 is involved in skin fibroblast ageing and is induced by a preparation of peptides and sugars derived from plant cell cultures[J]. Mol. Biotechnol., 2019, 61(3): 209-220. doi: 10.1007/s12033-019-00154-w
[22]	Lei D, Huang Y, Xie H, et al. Fluorofenidone inhibits UV-A induced senescence in human dermal fibroblasts via the mammalian target of rapamycin-dependent SIRT1 pathway[J]. J. Dermatol., 2018, 45(7): 791-798. doi: 10.1111/jde.2018.45.issue-7
[23]	Jiang S B, Lu Y S, Liu T, et al. UVA influenced the SIRT1-miR-27a-5p-SMAD2-MMP1/COL1/BCL2 axis in human skin primary fibroblasts[J]. J. Cell Mol. Med., 2020, 24(17): 10027-10041. doi: 10.1111/jcmm.v24.17
[24]	Ding S, Chen J, Zeng Q, et al. Chronic sun exposure is associated with distinct histone acetylation changes in human skin[J]. Br. J. Dermatol., 2018, 179(1): 110-117. doi: 10.1111/bjd.16129 pmid: 29150847

基因	方向	引物序列
COL1A2	F R	GTGGCAGTGATGGAAGTGTG AGGACCAGCGTTACCAACAG
COL4A1	F R	AGGTGTCATTGGGTTTCCTG GGTCCTCTTGTCCCTTTTGTT
ELN	F R	TCCAGGTGTAGGTGGAGCTT GTGTAGGGCAGTCCATAGCC
MMP1	F R	AAGGTGGACCAACAATTTCAGA TGAAGGTGTAGCTAGGGTACATCAA
MMP9	F R	CAGTCCACCCTTGTGCTCTT ATTTCGACTCTCCACGCATC
SIRT1	F R	CCCAGAACATAGACACGCTGGA TCAGCTGGGCACCTAGGACA
HDAC1	F R	ACCAAGTACCACAGCGATGACTACA CGAATACTGGACAGTCCTCACCAA
GDF11	F R	GTCATTAGCATGGCCCAGGA AGCTGGGCCTTCAGTACCTTTG
CDKN2A	F R	CCCCACTACCGTAAATGTCCA TGCTCACTCCAGAAAACTCCAA
TP53	F R	TCGAGATGTTCCGAGAGCTGAAT GTCTGAGTCAGGCCCTTCTGTCTT
CDKN1A	F R	CATGTGGACCTGTCACTGTCTTGTA GAAGATCAGCCGGCGTTTG
ACTB	F R	TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA

Dynamic changes of gene expression induced by long-wave ultraviolet radiation in human dermal fibroblasts

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 5

References 24

Related Articles 15

Metrics

Comments

Recommended 10

[1]	Jingxuan Liu, Jianming Jin, Hua Wu. Botanical cosmetic ingredients （VII）Research and development of plant antifungal [J]. China Surfactant Detergent & Cosmetics, 2024, 54(3): 259-266.
[2]	Wu Bi, Xiaohong Pan, Xiaoqin Tu, Shuai Yin, Hui Sun. Analysis of the mechanism of anti-sensitive skin effect of cosmetic raw material Stephania tetrandra based on network pharmacology [J]. China Surfactant Detergent & Cosmetics, 2024, 54(3): 305-312.
[3]	Yaoyao Li. Study on the anti-aging and antioxidant effects of isosinensetin [J]. China Surfactant Detergent & Cosmetics, 2024, 54(3): 313-319.
[4]	Liyuan Zhang, Linqi Yan, Qiaoyuan Cheng, Lvye Qi, Rong Wang, Liuqian Huang. Determination of 14 kinds of α-hydroxy acids and hydroxy esters in cosmetics [J]. China Surfactant Detergent & Cosmetics, 2024, 54(3): 353-359.
[5]	Wei Xu, Po Zou, Changyu Li, Ming Yang, Yan Lu, Huiliang Li. Determination of 36 stimulants in cosmetics by ultra performance liquid chromatography-tandem mass spectrometry [J]. China Surfactant Detergent & Cosmetics, 2024, 54(3): 360-368.
[6]	Kangfu Zhou, Yixuan Zhi, Feifei Wang, Yazhuo Shang. New emulsion system and its application in cosmetics （VI）Microemulsion [J]. China Surfactant Detergent & Cosmetics, 2024, 54(2): 139-148.
[7]	Zhen Xie, Wei Huang, Jinsong Zhang, Shuhuai Chen, Linji Qu, Rong Kuang. Study on biomarkers of corneal injury in the evaluation of eye irritation of cosmetics [J]. China Surfactant Detergent & Cosmetics, 2024, 54(2): 161-167.
[8]	Xiaohong Pan, Ziqi Gao, Zhen Chen, Shuai Yin, Haiping Huang, Bin Hu. Discussion on the current situation of research and management on the stability of cosmetic products in China [J]. China Surfactant Detergent & Cosmetics, 2024, 54(2): 201-208.
[9]	Li Lu, Fang Fang, Youlong Feng, Ling Cao. Screening for illegal addition of sulfonamides in cosmetic products using ultra-performance liquid chromatographytriple quadrupoletandem mass spectrometry with precursor ion scanning [J]. China Surfactant Detergent & Cosmetics, 2024, 54(2): 216-223.
[10]	Ren Wang, Yuanyang Wu, Jia Qiao, Linqi Yan, Cen Chen, Liyuan Zhang. Study on phenoxyethanol content in children’s cosmetics on the mark and preliminary risk assessment [J]. China Surfactant Detergent & Cosmetics, 2024, 54(2): 224-230.
[11]	Yixiang Lu, Liting Wu, Jimin Jiang, Hailu Chen, Xuan Huang. Determination of tolnaftate and liranaftate in cosmetics by high performance liquid chromatography and verification by high performance liquid chromatography-tandem mass spectrometry [J]. China Surfactant Detergent & Cosmetics, 2024, 54(2): 231-238.
[12]	Liyuan Zhang, Qiaoyuan Cheng, Cen Chen, Zehua Li, Liuqian Huang, Lvye Qi. Determination of 3 kinds of α-hydroxy acids and their esters in cosmetics by high performance liquid chromatography [J]. China Surfactant Detergent & Cosmetics, 2024, 54(1): 102-106.
[13]	Linling Lu, Hui Lu, Chunyan Min, Yefei Qian. Determination of functional components of Glycyrrhizae, Ginseng and Scutellariae in facial masks by UHPLC-MS/MS [J]. China Surfactant Detergent & Cosmetics, 2024, 54(1): 107-113.
[14]	Xu Han, Jiajia Wu, Na Wu, Yazhuo Shang. New emulsion system and its application in cosmetics （V） Janus emulsion [J]. China Surfactant Detergent & Cosmetics, 2024, 54(1): 24-31.
[15]	Feng Liu, Yuanchang Deng, Guohong Ying, Xiaowei Wang. Establishment of duplex-PCR method for rapid detection of Pluralibacter gergoviae [J]. China Surfactant Detergent & Cosmetics, 2024, 54(1): 45-50.