一种酿酒酵母和副干酪乳杆菌发酵产物滤液复合物对面部微生态的影响

doi:10.3969/j.issn.2097-2806.2023.11.001

Abstract

Abstract:

The objective of this study was to investigate the effects of a Himalaya-derived Saccharomyces and Lactobacillus ferment complex （SLFC） on the facial micro-ecology. Thirty women （30-45 years old, average 38 years old） with signs of skin aging used SLFC. Compared with the two groups of samples before use （D0） and after 28 days of use （D28）, the Alpha diversity of facial bacterial species decreased significantly and the Beta diversity had obvious differentiation in different regions. The relative abundance of Staphylococcus increased significantly. The relative abundance of Propionibacterium, Corynebacterium, Acinetobacter, and other skin resident bacteria remained stable. The relative abundance of the opportunistic pathogenic bacteria such as Streptococcus,Erythrococcus, Aquatic bacteria and flavobacterium decreased. At the species level, the abundance of Staphylococcus epidermidis increased significantly, the abundance of Cutibacterium acnes did not change significantly, and Staphylococcus aureus was not detected. According to the feedback of consumers after treatment with SLFC for 28 days, skin smoothness, gloss and moisture were improved and the skin redness was relieved. Therefore, SLFC can effectively regulate and stabilize the microecological balance of facial flora to improve and strengthen the skin barrier.

Key words: face, skin, barrier, micro-ecology, fermentation

CLC Number:

TQ658

Wang Yue, Li Jun, Gu Shihong, Wang Man, Zou Yue, Wu Jianming. Effects of a Saccharomyces cerevisiae and Lactobacillus paracasei ferment complex on the facial micro-ecology[J].China Surfactant Detergent & Cosmetics, 2023, 53(11): 1241-1249.

Figures/Tables 9

Tab. 1

Tab. 2

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Tab. 3

Tab. 4

References 19

[1]	Expert consensus on skin microecology and skin health (part 1: overview of skin microecology)[J]. Journal of Clinical Dermatology, 2022, 51 (11) : 701-704.
[2]	Grice E A. The skin microbiome: potential for novel diagnostic and therapeutic approaches to cutaneous disease[J]. Semin. Cutan. Med. Surg., 2014, 33 (2) : 98-103. doi: 10.12788/j.sder.0087 pmid: 25085669
[3]	Gui Yuhao, Zhou Wei. Skin microecology and its application in infant care products[J]. China Cleaning Industry Association, 2020 (6) : 119-123.
[4]	Grice E A, Kong H H, Renaud G, et al. A diversity profile of the human skin microbiota[J]. Genome Research, 2008, 18 (7) : 1043-1050. doi: 10.1101/gr.075549.107 pmid: 18502944
[5]	Li Dongqing, Li Zhiheng, Li Qian, et al. Progress in the regulation of immune response[J]. Chinese Journal of Dermatology, 2012 (3) : 215-217.
[6]	Zhao Qiming, Li Fei. Skin and gut microecology and probiotics[J]. Chinese Journal of Aesthetic Medicine, 2018, 27 (9) : 6-9.
[7]	Wu Jiahui, Ji Rui, Tan Jun, et al. Study on the effects of probiotics on skin health and their mechanism of action[J]. Industrial Microorganism, 2018, 48 (5) : 13-18.
[8]	Jiang Shanshan, Li Yan, Han Tingting, et al. Effect of cosmetics on skin microecology[J]. China Detergent Cosmetics, 2022, 45 (3) : 52-57.
[9]	Li Jun, Zhou Jing, Zhang Zhang, et al. Preparation of a brewer’s yeast fermentation product from a source of barley wine malt in the pan-himalayan region and its application: CN 114081862 A[P]. 2022-02-25.
[10]	Li Jun, Zhou Jing, Zhang Zhang, et al. Preparation of a fermentation product of lactobacillus casei from the lees of chicken claw valley wine in the pan-himalayan region and its application: CN 114073659 A[P]. 2022-02-22.
[11]	Gao Xiaoping, Mei Lingling, Li Chaoshi, et al. Detection of the TaqMan-MGB probe for S. aureus by real-time fluorescence PCR with the TaqMan-MGB probe[J]. Chinese Journal of Health Laboratory Technology, 2009 (1) : 120-123.
[12]	Wang Shan, Liu Ying, Ma Lin. Progress in skin microecology in the field of atopic dermatitis[J]. China Medical Abstracts, 2016, 33 (2) : 122-127.
[13]	Wang Y, Kuo S, Shu M, et al. Staphylococcus epidermidis in the human skin microbiome mediates fermentation to inhibit the growth of propionibacterium acnes: implications of probiotics in acne vulgaris[J]. Appl. Microbiol. Biotechnol., 2014, 98 (1) : 411-424. doi: 10.1007/s00253-013-5394-8 pmid: 24265031
[14]	Kong H H, Oh J, Deming C, et al. Temporal shifts in the skin microbiome associated with disease flares and treatment in children with atopic dermatitis[J]. Genome. Res., 2012, 22 (5) : 850-859. doi: 10.1101/gr.131029.111 pmid: 22310478
[15]	Wang Shan, Liu Ying, Ma Lin. Progress in skin microecology in the field of atopic dermatitis[J]. China Medical Abstracts, 2016, 33 (2) : 122-127.
[16]	Ouwehand A C, Batsman A, Salminen S. Probiotics for the skin: a new area of potential application?[J]. Microbiology, 2010, 36 (5) : 327-331.
[17]	Krutmann J. Pre- and probiotics for human skin[J]. Clinics in Plastic Surgery, 2012, 39 (1) : 59-64. doi: 10.1016/j.cps.2011.09.009 pmid: 22099848
[18]	Sobrino-lópez A, Martín-belloso O. Use of nisin and other bacteriocins for preservation of dairy products[J]. International Dairy Journal, 2008, 18 (4) : 329-343. doi: 10.1016/j.idairyj.2007.11.009
[19]	Anda N A, Mart Nez-larra A M R, Ar S I, et al. Chapter 1-prebiotics and probiotics: an assessment of their safety and health benefits[M]. Probiotics, Prebiotics, and Synbiotics. Elsevier Inc., 2016: 3-23.

Target	Sequence （5′-3′）
16S	338F：ACTCCTACGGGAGGCAGCAG
16S	806R：GGACTACHVGGGTWTCTAAT

Species	Target	Sequence （5′-3′）
Cutibacterium acnes （C. acnes）	16S	PA1-129F: 5′- GACTTTGGGATAACTTCAGGAAACTG-3′
		PA1-238R: 5′- CTGATAAGCCGCGAGTCCAT-3′
		PA1-195P: 5′-TTGGAAAGTTTCGGCGGTTG-3′
Staphylococcus epidermidis （S. epidermidis）	atlE	atlE_1610F: 5′- GGAGGAACTAATAATAAGTTAACTG-3′
		atlE_1702R: 5′- GTCATAAACAGTTGTATATAAGCC-3′
		atlE_1638P: 5′- CTGCTAATCGTGGTGTTGCTCAAATTAAA-3′
Staphylococcus aureus （S. aureus）	nuc	SAF: 5′-GCAAAGAAAATTGAAGTCGAGTT-3′
		SAR: 5′-AAATATACGCTAAGCCACGTCCAT-3′
		SAP: 5′-ACAAAGGTCAAAGAACTGATA-3′

Characteristic Bacteria	Microbial abundance/（copies/μL）
Characteristic Bacteria	D0（M±SD）	D28（M±SD）
C. acnes	（2.34±4.40） ×10⁷	（2.37±2.83） ×10⁷（p>0.05）
S. epidermidis	（1.17±2.18） ×10⁵	（3.64±8.29） ×10⁵（p<0.05）

Number	Question	W0			W4
Number	Question	Agree	Disagree	P	Agree	Disagree	P
1	Has the delicacy of your skin improved?	26	4	0.000	30	0	0.000
2	Has the smoothness of your skin improved?	24	6	0.001	29	1	0.000
3	Has the luster of your skin improved?	29	1	0.000	30	0	0.000
4	Has the elasticity of your skin improved?	19	11	0.051	27	3	0.000
5	Has the firmness of your skin improved?	23	7	0.002	27	3	0.000
6	Have the fine lines on your skin improved?	24	6	0.001	24	6	0.001
7	Has the dullness of your skin improved?	19	11	0.051	23	7	0.002
8	Has the yellowness of your skin improved?	19	11	0.051	24	6	0.001
9	Has the redness of your skin improved?	8	22	0.005	29	1	0.000
10	Has the sensitivity of your skin improved?	9	21	0.013	29	1	0.000

Effects of a Saccharomyces cerevisiae and Lactobacillus paracasei ferment complex on the facial micro-ecology

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 9

References 19

Related Articles 15

Metrics

Comments

Recommended 10

[1]	Guofeng Li, Kainan Liu, Wenlong Mo, Teng Ma. Performance evaluation of a system of imbibition oil displacement agent in shale reservoir [J]. China Surfactant Detergent & Cosmetics, 2024, 54(3): 250-258.
[2]	Cuicui Hu, Daihong Zhou, Xinwan Chen, Jialing Zhong, Canquan Mao. Efficacies and mechanisms of a formula of Chinese medicinal plants （MHC-20） against Streptococcus pyogenes [J]. China Surfactant Detergent & Cosmetics, 2024, 54(3): 282-289.
[3]	Wu Bi, Xiaohong Pan, Xiaoqin Tu, Shuai Yin, Hui Sun. Analysis of the mechanism of anti-sensitive skin effect of cosmetic raw material Stephania tetrandra based on network pharmacology [J]. China Surfactant Detergent & Cosmetics, 2024, 54(3): 305-312.
[4]	Hongling Zhang, Lin Cheng, Haiyan Wang, Feiya Luo, Huiliang Zhang, Lei Sun. Using DPRA alternative method to evaluate the skin sensitization of 3 coumarins [J]. China Surfactant Detergent & Cosmetics, 2024, 54(2): 156-160.
[5]	Kuankuan Gao, Suzhen Yang, Tingting Han, Yan Li, Chunying Yuan, Xinyu Mao. Research progress of royal jelly acid and its skin care efficacy [J]. China Surfactant Detergent & Cosmetics, 2024, 54(2): 209-215.
[6]	Yaru Wang, Tingyuan Mo, Hongxia Lai, Yue Zhou, Jiaying Xie, Jianhua Tan. Analysis of the causes of skin irritation of niacinamide cosmetics based on patch test and stability test [J]. China Surfactant Detergent & Cosmetics, 2024, 54(1): 51-56.
[7]	Anna Wang, Mengjie Fang, Chao Tang, Tianxiang Yue. Protective effect and antioxidant mechanism of Danshensu on UVB-induced skin photoaging in mice [J]. China Surfactant Detergent & Cosmetics, 2024, 54(1): 65-72.
[8]	Shen Yixin, Tang Lirong, Zhang Hui. Percutaneous permeation characteristics of tea polyphenols and its protective effect on human skin fibroblasts under the oxidative damage of ultraviolet A [J]. China Surfactant Detergent & Cosmetics, 2023, 53(9): 1035-1043.
[9]	Fang Tinghuan, Zheng Ting, Jiang Qing, Li Xiaoxia, Tang Lirong. Synergistic effect of silk peptides thermophilus fermentation on the skin anti-inflammatory and anti-aging activities [J]. China Surfactant Detergent & Cosmetics, 2023, 53(9): 1057-1064.
[10]	Huang Fang, Zhang Ying, Xiong Yue, Zhou Lidan, Lu Yina. The study of Magnolia biondii flower extract in relieving UVB-induced skin damage [J]. China Surfactant Detergent & Cosmetics, 2023, 53(9): 1065-1072.
[11]	Xiong Jie, Yang Dan, Meng Hong, He Yifan, Pei Xiaojing. Research progress in skin physiological effects and its cosmetic encapsulation technology of ferulic acid [J]. China Surfactant Detergent & Cosmetics, 2023, 53(9): 1073-1079.
[12]	Gu Weiwei. Optimal design method for packaging elements of daily skin care products under visual effects [J]. China Surfactant Detergent & Cosmetics, 2023, 53(9): 1094-1100.
[13]	Chang Shiteng, Cai Xiaojun, Zheng Yancheng, Liu Xuejin, Yi Xiao, Jiang Zhuyang. Physicochemical properties of ethoxylated sulfosuccinate surfactants and their interfacial properties when mixed with a betaine surfactant [J]. China Surfactant Detergent & Cosmetics, 2023, 53(9): 989-998.
[14]	Wan Zongyuan, Tong Wei, Zhou Chun, Hu Ping, Ouyang Sheng, Zhang Hongyang. Differential analysis of sensitive skin surface lipids based on lipidomics [J]. China Surfactant Detergent & Cosmetics, 2023, 53(9): 999-1007.
[15]	Xu Derong,Lian Wei,Xiong Jinzhao,Kang Wanli. Research on the influence factors of surfactant imbibition in tight reservoirs [J]. China Surfactant Detergent & Cosmetics, 2023, 53(8): 857-864.